Medusa Madison Litecoin Dog - Mix of Golder Retriever and Border Collie
Medusa Madison
  • Purity 67%
  • Age 15 days
  • Racing Exp 41
  • Golder Retriever 82%
  • Gold medal 3 Silver medal 1 Bronze medal 1
  • 9 races
  • Gen 9
Sad & Tardy

Achievements

Racer
Podium Champion
TOP 10 Fastest

Bio

Hey there! Baby, call me Medusa Madison. Once you go digital, baby, you never go back. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I've had my nose rubbed in 'it' more than once. I'm looking for a good Tug-O-War partner.

Racing Stats

Ran 9 races
  • 3 1 1
 Best Time15.02 sec
Rank 3  RacingĀ *** Pts
55.6 % wins (5) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: AGATACAGAAGATACAGAAGAAGAAGAAGAAGA
A
G
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
A
G
A
Genes: 8J88J888888

Composition

Golder Retriever
82%
Border Collie
18%

Current Energy

Vitality +58 points
Lunar Effect +14 points

Traits Breakdown

Body Golder Retriever
Tail Border Collie
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Golder Retriever
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever