Motaro Moonshine Litecoin Dog - Mix of Pug, German Shepard, Labrador BK, Labrador, Husky and Beagle

Achievements

Racer
Motaro Moonshine
Hey there! Baby, call me Motaro Moonshine. Once you go digital, baby, you never go back. I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them! I've had my nose rubbed in 'it' more than once. I'm looking for a good Tug-O-War partner.
  • Purity 23%
  • Age 4 months
  • Racing Exp 1
  • Pug 45%
  • 1 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
1 races    Best Time16.72 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAGAATCATCACCAGAAGAAGAAACACTA
G
C
A
G
A
A
G
A
A
T
C
A
T
C
A
C
C
A
G
A
A
G
A
A
G
A
A
A
C
A
C
T
A
Genes: 6227752224D

Composition

Pug
45%
German Shepard
18%
Labrador BK
9%
Labrador
9%
Husky
9%
Beagle
9%

Current Energy

Vitality -18 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Pug
Front Legs German Shepard
Head German Shepard
Ears Labrador
Snout Pug
Mouth Pug
Nose Pug
Eyes Husky
Color Beagle

Parents

No Children

Photos

Litecoin canine racing Bitcoin pet race crypto dog race podium virtual canine racing photo online canine racing Bitcoin dog race photo cryptocurrency pet racing Bitcoin canine race photo