Pockets Patches

If you'd like to get together, I'm Pockets Patches. The absolute best time of day is dinner time! I need laid otherwise I'm going to start agreeing with Grumpy Cat. I enjoy chasing my tail around. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.

Purity 6%
Age 3 months
Racing Exp 0

Labrador BK 18%
0 races
Gen 0

Sad & Tardy

Energy: ▂▃▅▆▇

Racing Stats

0 0 0


0 races	Best Time	--
No rank	Racing	*** Coins
0.0 % wins (0)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: GCATGATCAGCACACGGAGGACCAAACTCATTA

Genes: 6B76HAA5G7F

Composition

Labrador BK	18%
German Shepard	18%
Dachshund	18%
St. Bernard	9%
Rottweiler	9%
Labrador	9%
Boxer	9%
Yorkshire Terrier	9%

Current Energy

Vitality	-6 points
Lunar Effect	+4 points

Traits Breakdown

Body	Labrador BK
Tail	St. Bernard
Legs	German Shepard
Front Legs	Labrador BK
Head	Rottweiler
Ears	Dachshund
Snout	Dachshund
Mouth	Labrador
Nose	Boxer
Eyes	German Shepard
Color	Yorkshire Terrier

Parents

Satoshi the Unicorn

Children