Pockets Patches Litecoin Dog - Mix of Labrador BK, German Shepard, Dachshund, St. Bernard, Rottweiler, Labrador, Boxer and Yorkshire Terrier

Achievements

None
Pockets Patches
If you'd like to get together, I'm Pockets Patches. The absolute best time of day is dinner time! I need laid otherwise I'm going to start agreeing with Grumpy Cat. I enjoy chasing my tail around. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 6%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATGATCAGCACACGGAGGACCAAACTCATTA
G
C
A
T
G
A
T
C
A
G
C
A
C
A
C
G
G
A
G
G
A
C
C
A
A
A
C
T
C
A
T
T
A
Genes: 6B76HAA5G7F

Composition

Labrador BK
18%
German Shepard
18%
Dachshund
18%
St. Bernard
9%
Rottweiler
9%
Labrador
9%
Boxer
9%
Yorkshire Terrier
9%

Current Energy

Vitality -6 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail St. Bernard
Legs German Shepard
Front Legs Labrador BK
Head Rottweiler
Ears Dachshund
Snout Dachshund
Mouth Labrador
Nose Boxer
Eyes German Shepard
Color Yorkshire Terrier