Jett Jalopy Crypto Game Dog - Mix of Golder Retriever, Border Collie, Schnauzer and Poodle

Achievements

None
Jett Jalopy
Hey dawg! I'm Jett Jalopy. The Ethernet where I live, rocks. I am not above stealing food off humans' plates. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I want a friend to poop with me in my neighbor's yard, just to watch him turn all shades of red.
  • Purity 39%
  • Age 40 months
  • Racing Exp 0
  • Golder Retriever 64%
  • 0 races
  • Gen 5
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ATAGACAGAAGATACAGAAGATACAGAAGAAGA
A
T
A
G
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
T
A
C
A
G
A
A
G
A
A
G
A
Genes: CI88J88J888

Composition

Golder Retriever
64%
Border Collie
18%
Schnauzer
9%
Poodle
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Poodle
Legs Golder Retriever
Front Legs Golder Retriever
Head Border Collie
Ears Golder Retriever
Snout Golder Retriever
Mouth Border Collie
Nose Golder Retriever
Eyes Golder Retriever
Color Golder Retriever