Max Payne Mario Crypto Dog - Mix of Golder Retriever, Shiba Inu, Poodle, Yorkshire Terrier, Pug, German Shepard, Corgi, Pitbull terrier, Grey Wolf and St. Bernard

Achievements

Podium Champion
Pro Racer
Max Payne Mario
As a good digital dog, my humans give me virtually everything. They say my bite is worse than my bark. I don't like going to the groomer. Leave my beautiful fur alone! I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I like exploring off leash best.
  • Purity 3%
  • Age 43 months
  • Racing Exp 61
  • Golder Retriever 18%
  • 17 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

17 races   |
  • 3 3 1
 Best Time14.72 sec
Rank 30  Racing *** Coins
41.2 % wins (7) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: AGAGTAGACTTAGAATCAAGCTCCCCCTGAAGA
A
G
A
G
T
A
G
A
C
T
T
A
G
A
A
T
C
A
A
G
C
T
C
C
C
C
C
T
G
A
A
G
A
Genes: 8EIF27ONLB8

Composition

Golder Retriever
18%
Shiba Inu
9%
Poodle
9%
Yorkshire Terrier
9%
Pug
9%
German Shepard
9%
Corgi
9%
Pitbull terrier
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality -43 points
Lunar Effect -2 points

Traits Breakdown

Body Golder Retriever
Tail Shiba Inu
Legs Poodle
Front Legs Yorkshire Terrier
Head Pug
Ears German Shepard
Snout Corgi
Mouth Pitbull terrier
Nose Grey Wolf
Eyes St. Bernard
Color Golder Retriever