Zoie Zorro Crypto Game Dog - Mix of Labrador, German Shepard, Husky, St. Bernard, Dachshund and Pug
Zoie Zorro
  • Purity 20%
  • Age 4 months
  • Racing Exp 0
  • Labrador 36%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 0 races
  • Gen 1
Depressed & Snaillike

Achievements

None

Bio

I believe running along the beach to catch a stick can be nearly orgasmic. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I hate it when my humans fart and they blame me! I slept with a cat and I liked it.

Racing Stats

Ran 0 races
  • 0 0 0
 Best Time--
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACATGATCATCATCAGGACCACCACCAGAACCA
A
C
A
T
G
A
T
C
A
T
C
A
T
C
A
G
G
A
C
C
A
C
C
A
C
C
A
G
A
A
C
C
A
Genes: 4B777A55525

Composition

Labrador
36%
German Shepard
27%
Husky
9%
St. Bernard
9%
Dachshund
9%
Pug
9%

Current Energy

Vitality +3 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail St. Bernard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Dachshund
Snout Labrador
Mouth Labrador
Nose Labrador
Eyes Pug
Color Labrador