Zoie Zorro Crypto Game Dog - Mix of Labrador, German Shepard, Husky, St. Bernard, Dachshund and Pug

Achievements

None
Zoie Zorro
I believe running along the beach to catch a stick can be nearly orgasmic. Forget plastic hotdogs...I'm into the classic chew toys like slippers. I hate it when my humans fart and they blame me! I slept with a cat and I liked it.
  • Purity 20%
  • Age 9 months
  • Racing Exp 0
  • Labrador 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATGATCATCATCAGGACCACCACCAGAACCA
A
C
A
T
G
A
T
C
A
T
C
A
T
C
A
G
G
A
C
C
A
C
C
A
C
C
A
G
A
A
C
C
A
Genes: 4B777A55525

Composition

Labrador
36%
German Shepard
27%
Husky
9%
St. Bernard
9%
Dachshund
9%
Pug
9%

Current Energy

Vitality +3 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail St. Bernard
Legs German Shepard
Front Legs German Shepard
Head German Shepard
Ears Dachshund
Snout Labrador
Mouth Labrador
Nose Labrador
Eyes Pug
Color Labrador