Skyler Spud Crypto Dog - Mix of Golder Retriever, Labrador, Grey Wolf, Pitbull terrier, Corgi and Rottweiler

Achievements

Racer
Skyler Spud
I am a web of clouds kind of dog. You know the worst? Watching my humans 'get it on' and I have to lick myself. As a designer, I suggest low windows or couch backs next to windows without curtains. I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 18%
  • Age 24 months
  • Racing Exp 13
  • Golder Retriever 45%
  • 3 races
  • Gen 3
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

3 races   |
  • 0 0 2
 Best Time15.98 sec
No rank  Racing *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCAGACCATCCAGAAGCAGACCACACAGAAGA
C
C
C
A
G
A
C
C
A
T
C
C
A
G
A
A
G
C
A
G
A
C
C
A
C
A
C
A
G
A
A
G
A
Genes: L85N8O85H88

Composition

Golder Retriever
45%
Labrador
18%
Grey Wolf
9%
Pitbull terrier
9%
Corgi
9%
Rottweiler
9%

Current Energy

Vitality -29 points
Lunar Effect -16 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs Labrador
Front Legs Pitbull terrier
Head Golder Retriever
Ears Corgi
Snout Golder Retriever
Mouth Labrador
Nose Rottweiler
Eyes Golder Retriever
Color Golder Retriever