Jess Jango Litecoin Dog - Mix of Boxer, Border Collie, Schnauzer, Golder Retriever, Shiba Inu, Labrador BK, Dachshund and German Shepard

Achievements

None
Jess Jango
Jess Jango is the name, love is my game. And fetch of course... Currently, I live on the information superhighway. I need laid otherwise I'm going to start agreeing with Grumpy Cat. I hate having to wear foo-foo clothes and ribbons in my fur. If we can run as a pack for a while, I'm open to that.
  • Purity 4%
  • Age 42 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Neutral & Casual
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAAACTACGTATACAACATAGCAGGATCAATA
A
G
A
A
A
C
T
A
C
G
T
A
T
A
C
A
A
C
A
T
A
G
C
A
G
G
A
T
C
A
A
T
A
Genes: 8GJEJGC6A7C

Composition

Boxer
18%
Border Collie
18%
Schnauzer
18%
Golder Retriever
9%
Shiba Inu
9%
Labrador BK
9%
Dachshund
9%
German Shepard
9%

Current Energy

Vitality -17 points
Lunar Effect -2 points

Traits Breakdown

Body Golder Retriever
Tail Boxer
Legs Border Collie
Front Legs Shiba Inu
Head Border Collie
Ears Boxer
Snout Schnauzer
Mouth Labrador BK
Nose Dachshund
Eyes German Shepard
Color Schnauzer