Amigo Ace Cryptocurrency Dog - Mix of Border Collie, Pug, Boxer, Beagle, St. Bernard, Corgi, Pitbull terrier, Rottweiler, German Shepard and Husky

Achievements

Racer
Podium Champion
Amigo Ace
My name is Amigo Ace and I'd really like to sniff you. I'm 100% digital, baby. I'll outrun you for the ball if I can...that's just how I roll. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! If you enjoy growling through fences as much as I do, we should get together.
  • Purity 1%
  • Age 42 months
  • Racing Exp 22
  • Border Collie 18%
  • 4 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 1
4 races    Best Time15.48 sec
No rank  Racing *** Coins
75.0 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAAAACTACCTATACTGAAGCTCCCACTCAACA
G
A
A
A
A
C
T
A
C
C
T
A
T
A
C
T
G
A
A
G
C
T
C
C
C
A
C
T
C
A
A
C
A
Genes: 2GJDJBONH74

Composition

Border Collie
18%
Pug
9%
Boxer
9%
Beagle
9%
St. Bernard
9%
Corgi
9%
Pitbull terrier
9%
Rottweiler
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality -35 points
Lunar Effect +6 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Border Collie
Front Legs Beagle
Head Border Collie
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Rottweiler
Eyes German Shepard
Color Husky