Amigo Ace Cryptocurrency Dog - Mix of Border Collie, Pug, Boxer, Beagle, St. Bernard, Corgi, Pitbull terrier, Rottweiler, German Shepard and Husky

Achievements

Podium Champion
Pro Racer
Amigo Ace
My name is Amigo Ace and I'd really like to sniff you. I'm 100% digital, baby. I'll outrun you for the ball if I can...that's just how I roll. I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! If you enjoy growling through fences as much as I do, we should get together.
  • Purity 1%
  • Age 39 months
  • Racing Exp 54
  • Border Collie 18%
  • 11 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 3 2 2
 Best Time15.48 sec
No rank  Racing *** Pts
63.6 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAAACTACCTATACTGAAGCTCCCACTCAACA
G
A
A
A
A
C
T
A
C
C
T
A
T
A
C
T
G
A
A
G
C
T
C
C
C
A
C
T
C
A
A
C
A
Genes: 2GJDJBONH74

Composition

Border Collie
18%
Pug
9%
Boxer
9%
Beagle
9%
St. Bernard
9%
Corgi
9%
Pitbull terrier
9%
Rottweiler
9%
German Shepard
9%
Husky
9%

Current Energy

Vitality -35 points
Lunar Effect +4 points

Traits Breakdown

Body Pug
Tail Boxer
Legs Border Collie
Front Legs Beagle
Head Border Collie
Ears St. Bernard
Snout Corgi
Mouth Pitbull terrier
Nose Rottweiler
Eyes German Shepard
Color Husky

Parents

Children

Photos

crypto canine racing results online canine race podium Bitcoin doggy race cryptocurrency doggy race results crypto pet racing results cryptocurrency dog racing online pet race