Tabby Tucker Bitcoin Game Dog - Mix of Schnauzer, Golder Retriever, Poodle, Pug, Shiba Inu, Grey Wolf, Boxer, Labrador BK, Dachshund and St. Bernard

Achievements

None
Tabby Tucker
The absolute best time of day is dinner time! I hate it when my humans fool me with a pill in peanut butter! My 'G' spot is under my chin...scratch me there and I'll growl softly. I like nibbling on most everything, but I'll bite if you want me to.
  • Purity 1%
  • Age 39 months
  • Racing Exp 0
  • Schnauzer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AGAGACGAAGTACCCAACATAGCAGGATGAATA
A
G
A
G
A
C
G
A
A
G
T
A
C
C
C
A
A
C
A
T
A
G
C
A
G
G
A
T
G
A
A
T
A
Genes: 8I2ELGC6ABC

Composition

Schnauzer
18%
Golder Retriever
9%
Poodle
9%
Pug
9%
Shiba Inu
9%
Grey Wolf
9%
Boxer
9%
Labrador BK
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality -42 points
Lunar Effect -10 points

Traits Breakdown

Body Golder Retriever
Tail Poodle
Legs Pug
Front Legs Shiba Inu
Head Grey Wolf
Ears Boxer
Snout Schnauzer
Mouth Labrador BK
Nose Dachshund
Eyes St. Bernard
Color Schnauzer