Fifi Fluff Litecoin Dog - Mix of Dachshund, Labrador BK, German Shepard, Pug, French Bulldog, Shiba Inu, Boxer, Corgi and Husky

Achievements

Racer
Podium Champion
Fifi Fluff
I'm going kill that damn Nyan Cat if I can catch it. I enjoy staying active, and running circles around puppies and young children. Power outages and computer viruses scare me! The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 6%
  • Age 24 months
  • Racing Exp 37
  • Dachshund 27%
  • 14 races
  • Gen 2
Share it to make him Happy!
Happy & Quick
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 1 1 2
 Best Time15.75 sec
No rank  Racing *** Pts
28.6 % wins (4) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATCAGAACGAGTAAACAGCGGAGGAACAGGA
G
C
A
T
C
A
G
A
A
C
G
A
G
T
A
A
A
C
A
G
C
G
G
A
G
G
A
A
C
A
G
G
A
Genes: 6729EGOAA4A

Composition

Dachshund
27%
Labrador BK
9%
German Shepard
9%
Pug
9%
French Bulldog
9%
Shiba Inu
9%
Boxer
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -36 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Pug
Front Legs French Bulldog
Head Shiba Inu
Ears Boxer
Snout Corgi
Mouth Dachshund
Nose Dachshund
Eyes Husky
Color Dachshund