Fifi Fluff Litecoin Dog - Mix of Dachshund, Labrador BK, German Shepard, Pug, French Bulldog, Shiba Inu, Boxer, Corgi and Husky
Fifi Fluff
  • Purity 6%
  • Age 21 months
  • Racing Exp 15
  • Dachshund 27%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 4 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

I'm going kill that damn Nyan Cat if I can catch it. I enjoy staying active, and running circles around puppies and young children. Power outages and computer viruses scare me! The place I like most in the world is curled up in my human's bed, hogging all the covers!

Racing Stats

Ran 4 races
  • 0 1 1
 Best Time16.85 sec
No rank  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GCATCAGAACGAGTAAACAGCGGAGGAACAGGA
G
C
A
T
C
A
G
A
A
C
G
A
G
T
A
A
A
C
A
G
C
G
G
A
G
G
A
A
C
A
G
G
A
Genes: 6729EGOAA4A

Composition

Dachshund
27%
Labrador BK
9%
German Shepard
9%
Pug
9%
French Bulldog
9%
Shiba Inu
9%
Boxer
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -36 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Pug
Front Legs French Bulldog
Head Shiba Inu
Ears Boxer
Snout Corgi
Mouth Dachshund
Nose Dachshund
Eyes Husky
Color Dachshund

Parents

No Children

Photos

Litecoin dog racing photo virtual dog race
Gift