Tiger Tommy-Boy Cryptocurrency Game Dog - Mix of Dachshund, Labrador BK, German Shepard, Rottweiler, French Bulldog, Shiba Inu, Pug, Corgi, Pitbull terrier and Husky

Achievements

Racer
Podium Champion
Tiger Tommy-Boy
Hello, I be Tiger Tommy-Boy. My favorite place to sleep is under the covers between my humans. I'm not into dog collars, unless you're into S & M. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I am not above stealing food off humans' plates.
  • Purity 1%
  • Age 39 months
  • Racing Exp 62
  • Dachshund 18%
  • 18 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

18 races   |
  • 1 2 5
 Best Time15.30 sec
No rank  Racing *** Pts
44.4 % wins (8) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCATCACACCGAGTAGAAAGCGGATCCACAGGA
G
C
A
T
C
A
C
A
C
C
G
A
G
T
A
G
A
A
A
G
C
G
G
A
T
C
C
A
C
A
G
G
A
Genes: 67H9E2OAN4A

Composition

Dachshund
18%
Labrador BK
9%
German Shepard
9%
Rottweiler
9%
French Bulldog
9%
Shiba Inu
9%
Pug
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Rottweiler
Front Legs French Bulldog
Head Shiba Inu
Ears Pug
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes Husky
Color Dachshund