Tiger Tommy-Boy Cryptocurrency Game Dog - Mix of Dachshund, Labrador BK, German Shepard, Rottweiler, French Bulldog, Shiba Inu, Pug, Corgi, Pitbull terrier and Husky

Achievements

Racer
Tiger Tommy-Boy
Hello, I be Tiger Tommy-Boy. My favorite place to sleep is under the covers between my humans. I'm not into dog collars, unless you're into S & M. I enjoy finding and eating frozen cat turds in the winter. Bon appétit! I am not above stealing food off humans' plates.
  • Purity 1%
  • Age 43 months
  • Racing Exp 24
  • Dachshund 18%
  • 7 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 1 0 2
 Best Time15.30 sec
No rank  Racing *** Coins
42.9 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCATCACACCGAGTAGAAAGCGGATCCACAGGA
G
C
A
T
C
A
C
A
C
C
G
A
G
T
A
G
A
A
A
G
C
G
G
A
T
C
C
A
C
A
G
G
A
Genes: 67H9E2OAN4A

Composition

Dachshund
18%
Labrador BK
9%
German Shepard
9%
Rottweiler
9%
French Bulldog
9%
Shiba Inu
9%
Pug
9%
Corgi
9%
Pitbull terrier
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail German Shepard
Legs Rottweiler
Front Legs French Bulldog
Head Shiba Inu
Ears Pug
Snout Corgi
Mouth Dachshund
Nose Pitbull terrier
Eyes Husky
Color Dachshund