Yaka Yukon Litecoin Dog - Mix of Dachshund, Labrador, German Shepard, Rottweiler, Golder Retriever, Shiba Inu, Pug, Grey Wolf, Border Collie and Husky
Yaka Yukon
  • Purity 1%
  • Age 34 months
  • Racing Exp 52
  • Dachshund 18%
  • Gold medal 2 Silver medal 3 Bronze medal 2
  • 10 races
  • Gen 0
Depressed & Snaillike

Achievements

Podium Champion
Pro Racer

Bio

Ima cyber dog. I like big butts, I cannot lie. I adore sleeping upside down with my tongue hanging out! I hate it when other dogs pee in my yard! IT'S MY YARD!! Squeaky toys are the best, don't you agree?

Racing Stats

Ran 10 races
  • 2 3 2
 Best Time15.33 sec
No rank  RacingĀ *** Pts
70.0 % wins (7) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCATCACACAGAGTAGAAGGACCCTACACAGGA
C
C
A
T
C
A
C
A
C
A
G
A
G
T
A
G
A
A
G
G
A
C
C
C
T
A
C
A
C
A
G
G
A
Genes: 57H8E2ALJ4A

Composition

Dachshund
18%
Labrador
9%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
Shiba Inu
9%
Pug
9%
Grey Wolf
9%
Border Collie
9%
Husky
9%

Current Energy

Vitality -13 points
Lunar Effect -14 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Rottweiler
Front Legs Golder Retriever
Head Shiba Inu
Ears Pug
Snout Dachshund
Mouth Grey Wolf
Nose Border Collie
Eyes Husky
Color Dachshund