Yaka Yukon Litecoin Dog - Mix of Dachshund, Labrador, German Shepard, Rottweiler, Golder Retriever, Shiba Inu, Pug, Grey Wolf, Border Collie and Husky

Achievements

Podium Champion
Pro Racer
Master Champion
Yaka Yukon
Ima cyber dog. I like big butts, I cannot lie. I adore sleeping upside down with my tongue hanging out! I hate it when other dogs pee in my yard! IT'S MY YARD!! Squeaky toys are the best, don't you agree?
  • Purity 1%
  • Age 39 months
  • Racing Exp 80
  • Dachshund 18%
  • 21 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

21 races   |
  • 2 5 3
 Best Time15.33 sec
No rank  Racing *** Pts
47.6 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCATCACACAGAGTAGAAGGACCCTACACAGGA
C
C
A
T
C
A
C
A
C
A
G
A
G
T
A
G
A
A
G
G
A
C
C
C
T
A
C
A
C
A
G
G
A
Genes: 57H8E2ALJ4A

Composition

Dachshund
18%
Labrador
9%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
Shiba Inu
9%
Pug
9%
Grey Wolf
9%
Border Collie
9%
Husky
9%

Current Energy

Vitality -13 points
Lunar Effect -14 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Rottweiler
Front Legs Golder Retriever
Head Shiba Inu
Ears Pug
Snout Dachshund
Mouth Grey Wolf
Nose Border Collie
Eyes Husky
Color Dachshund