Cherokee Czar Litecoin Game Dog - Mix of German Shepard, Dachshund and Husky

Achievements

None
Cherokee Czar
Hi, Cherokee Czar is my name. Baby, I'm made from the same stuff as dreams. I don't like going to the groomer. Leave my beautiful fur alone! I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Getting out of a long relationship, not looking for another
  • Purity 51%
  • Age 40 months
  • Racing Exp 0
  • German Shepard 73%
  • 0 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCATCATCAACATCAGGATCATCATCAGGA
T
C
A
T
C
A
T
C
A
T
C
A
A
C
A
T
C
A
G
G
A
T
C
A
T
C
A
T
C
A
G
G
A
Genes: 777747A777A

Composition

German Shepard
73%
Dachshund
18%
Husky
9%

Current Energy

Vitality -7 points
Lunar Effect -6 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs German Shepard
Front Legs German Shepard
Head Husky
Ears German Shepard
Snout Dachshund
Mouth German Shepard
Nose German Shepard
Eyes German Shepard
Color Dachshund