Mary Mia Litecoin Dog - Mix of Labrador, Dachshund, German Shepard, Rottweiler, Golder Retriever, Pug, Grey Wolf, St. Bernard and Husky
Mary Mia
  • Purity 3%
  • Age 18 months
  • Racing Exp 16
  • Labrador 18%
  • Gold medal 1 Silver medal 0 Bronze medal 1
  • 4 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

How's it going? I'm Mary Mia. I don't mind sharing my bed with someone I just met, if we can cuddle. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I need to find someone tuff to help me protect our pups from that scheming mailman!

Racing Stats

Ran 4 races
  • 1 0 1
 Best Time15.00 sec
Rank 53  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCATCACACAGACCAGAAGGACCCTGAACAGGA
C
C
A
T
C
A
C
A
C
A
G
A
C
C
A
G
A
A
G
G
A
C
C
C
T
G
A
A
C
A
G
G
A
Genes: 57H852ALB4A

Composition

Labrador
18%
Dachshund
18%
German Shepard
9%
Rottweiler
9%
Golder Retriever
9%
Pug
9%
Grey Wolf
9%
St. Bernard
9%
Husky
9%

Current Energy

Vitality -20 points
Lunar Effect -14 points

Traits Breakdown

Body Labrador
Tail German Shepard
Legs Rottweiler
Front Legs Golder Retriever
Head Labrador
Ears Pug
Snout Dachshund
Mouth Grey Wolf
Nose St. Bernard
Eyes Husky
Color Dachshund