Pebbles Pepe Litecoin Dog - Mix of Corgi, Maltese, German Shepard, Golder Retriever, Boxer, Border Collie, French Bulldog, St. Bernard, Husky and Dachshund
Pebbles Pepe
  • Purity 1%
  • Age 34 months
  • Racing Exp 31
  • Corgi 18%
  • Gold medal 3 Silver medal 1 Bronze medal 0
  • 4 races
  • Gen 2
Sad & Slothful

Achievements

Racer
TOP 10 Fastest

Bio

I don't like having to stay in the car when my people go inside. I never met a crotch or a butt I didn't like, but I'm just friendly that way. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to respond to sad puppy eyes with sad puppy eyes of my own.

Racing Stats

Ran 4 races
  • 3 1 0
 Best Time15.28 sec
Rank 4  RacingĀ *** Pts
100.0% wins (4) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCTCAAGCAGAAACAGCTACCGATGAACAGGA
A
C
C
T
C
A
A
G
C
A
G
A
A
A
C
A
G
C
T
A
C
C
G
A
T
G
A
A
C
A
G
G
A
Genes: K7O8GOJ9B4A

Composition

Corgi
18%
Maltese
9%
German Shepard
9%
Golder Retriever
9%
Boxer
9%
Border Collie
9%
French Bulldog
9%
St. Bernard
9%
Husky
9%
Dachshund
9%

Current Energy

Vitality -47 points
Lunar Effect +8 points

Traits Breakdown

Body Maltese
Tail German Shepard
Legs Corgi
Front Legs Golder Retriever
Head Boxer
Ears Corgi
Snout Border Collie
Mouth French Bulldog
Nose St. Bernard
Eyes Husky
Color Dachshund

Parents

No Children

Photos

online pet race photo crypto canine racing podium virtual pet racing crypto pet race podium
Gift