Ryu Ralphie Litecoin Dog - Mix of French Bulldog, Rottweiler, Shiba Inu, Boxer, Golder Retriever, Border Collie, Pitbull terrier, Poodle and Labrador

Achievements

None
Ryu Ralphie
I don't like having to stay in the car when my people go inside. I never met a crotch or a butt I didn't like, but I'm just friendly that way. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I like to respond to sad puppy eyes with sad puppy eyes of my own.
  • Purity 5%
  • Age 3 months
  • Racing Exp 0
  • French Bulldog 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGTAAACAGATACTCCCGACACCACGACCCA
C
G
A
G
T
A
A
A
C
A
G
A
T
A
C
T
C
C
C
G
A
C
A
C
C
A
C
G
A
C
C
C
A
Genes: 9EG8JN9HHI5

Composition

French Bulldog
18%
Rottweiler
18%
Shiba Inu
9%
Boxer
9%
Golder Retriever
9%
Border Collie
9%
Pitbull terrier
9%
Poodle
9%
Labrador
9%

Current Energy

Vitality -27 points
Lunar Effect -14 points

Traits Breakdown

Body French Bulldog
Tail Shiba Inu
Legs Boxer
Front Legs Golder Retriever
Head Border Collie
Ears Pitbull terrier
Snout French Bulldog
Mouth Rottweiler
Nose Rottweiler
Eyes Poodle
Color Labrador

Parents

No Children