Emily Eve Bitcoin Dog - Mix of Corgi, French Bulldog, Yorkshire Terrier, Maltese, Poodle, Boxer, Border Collie and Labrador BK

Achievements

Racer
Emily Eve
What's up, dog? I'm Emily Eve! I'm a serial monogamist. I could spend days on end chasing my tail. I get so close but it's just so fast! I like never worrying about my dog poo. I've got people for that. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right?
  • Purity 6%
  • Age 20 months
  • Racing Exp 9
  • Corgi 18%
  • 3 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time15.98 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGACAGCCGAAACAGCTACCGAGCATTATTA
A
C
C
G
A
C
A
G
C
C
G
A
A
A
C
A
G
C
T
A
C
C
G
A
G
C
A
T
T
A
T
T
A
Genes: KIO9GOJ96FF

Composition

Corgi
18%
French Bulldog
18%
Yorkshire Terrier
18%
Maltese
9%
Poodle
9%
Boxer
9%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -60 points
Lunar Effect -6 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Corgi
Front Legs French Bulldog
Head Boxer
Ears Corgi
Snout Border Collie
Mouth French Bulldog
Nose Labrador BK
Eyes Yorkshire Terrier
Color Yorkshire Terrier