Emily Eve Bitcoin Dog - Mix of Corgi, French Bulldog, Yorkshire Terrier, Maltese, Poodle, Boxer, Border Collie and Labrador BK
Emily Eve
  • Purity 6%
  • Age 17 months
  • Racing Exp 18
  • Corgi 18%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 7 races
  • Gen 0
Sad & Tardy

Achievements

Racer

Bio

What's up, dog? I'm Emily Eve! I'm a serial monogamist. I could spend days on end chasing my tail. I get so close but it's just so fast! I like never worrying about my dog poo. I've got people for that. Those Elizabethan cone collars are awful! You gotta lick when you gotta lick, am I right?

Racing Stats

Ran 7 races
  • 0 1 1
 Best Time15.98 sec
No rank  RacingĀ *** Pts
28.6 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCGACAGCCGAAACAGCTACCGAGCATTATTA
A
C
C
G
A
C
A
G
C
C
G
A
A
A
C
A
G
C
T
A
C
C
G
A
G
C
A
T
T
A
T
T
A
Genes: KIO9GOJ96FF

Composition

Corgi
18%
French Bulldog
18%
Yorkshire Terrier
18%
Maltese
9%
Poodle
9%
Boxer
9%
Border Collie
9%
Labrador BK
9%

Current Energy

Vitality -60 points
Lunar Effect -8 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Corgi
Front Legs French Bulldog
Head Boxer
Ears Corgi
Snout Border Collie
Mouth French Bulldog
Nose Labrador BK
Eyes Yorkshire Terrier
Color Yorkshire Terrier