Myrtle Melody Bitcoin Dog - Mix of Boxer, Corgi, Maltese, Poodle, Border Collie, Pug, Labrador BK and Husky
Myrtle Melody
  • Purity 9%
  • Age 13 months
  • Racing Exp 2
  • Boxer 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer

Bio

I hate it when I am not the center of attention. When I can break free, I enjoy exploring my neighborhood without my human. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I've always had a crush on Lassie.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time17.15 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: ACCGACAACAACAACAGCTACGAAGCAAGCACA
A
C
C
G
A
C
A
A
C
A
A
C
A
A
C
A
G
C
T
A
C
G
A
A
G
C
A
A
G
C
A
C
A
Genes: KIGGGOJ26O4

Composition

Boxer
27%
Corgi
18%
Maltese
9%
Poodle
9%
Border Collie
9%
Pug
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -60 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Corgi
Snout Border Collie
Mouth Pug
Nose Labrador BK
Eyes Corgi
Color Husky

Parents

No Children

Photos

Gift