Myrtle Melody Bitcoin Dog - Mix of Boxer, Corgi, Maltese, Poodle, Border Collie, Pug, Labrador BK and Husky

Achievements

Racer
Myrtle Melody
I hate it when I am not the center of attention. When I can break free, I enjoy exploring my neighborhood without my human. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I've always had a crush on Lassie.
  • Purity 9%
  • Age 21 months
  • Racing Exp 9
  • Boxer 27%
  • 3 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time16.72 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCGACAACAACAACAGCTACGAAGCAAGCACA
A
C
C
G
A
C
A
A
C
A
A
C
A
A
C
A
G
C
T
A
C
G
A
A
G
C
A
A
G
C
A
C
A
Genes: KIGGGOJ26O4

Composition

Boxer
27%
Corgi
18%
Maltese
9%
Poodle
9%
Border Collie
9%
Pug
9%
Labrador BK
9%
Husky
9%

Current Energy

Vitality -60 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Poodle
Legs Boxer
Front Legs Boxer
Head Boxer
Ears Corgi
Snout Border Collie
Mouth Pug
Nose Labrador BK
Eyes Corgi
Color Husky