Violet Victoria Litecoin Game Dog - Mix of Boxer, Pug, Husky, Beagle, Schnauzer, Dachshund and Corgi

Achievements

Podium Champion
Pro Racer
Violet Victoria
Salutations! My name's Violet Victoria. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I hate it when my humans fool me with a pill in peanut butter!
  • Purity 9%
  • Age 18 months
  • Racing Exp 53
  • Boxer 27%
  • 11 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 1 5 1
 Best Time15.60 sec
No rank  Racing *** Pts
63.6 % wins (7) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTAGAAAACACAAACAACATAGAAGGAAGCACA
C
T
A
G
A
A
A
A
C
A
C
A
A
A
C
A
A
C
A
T
A
G
A
A
G
G
A
A
G
C
A
C
A
Genes: D2G4GGC2AO4

Composition

Boxer
27%
Pug
18%
Husky
18%
Beagle
9%
Schnauzer
9%
Dachshund
9%
Corgi
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Boxer
Front Legs Husky
Head Boxer
Ears Boxer
Snout Schnauzer
Mouth Pug
Nose Dachshund
Eyes Corgi
Color Husky