Violet Victoria Litecoin Game Dog - Mix of Boxer, Pug, Husky, Beagle, Schnauzer, Dachshund and Corgi
Violet Victoria
  • Purity 9%
  • Age 13 months
  • Racing Exp 20
  • Boxer 27%
  • Gold medal 0 Silver medal 2 Bronze medal 1
  • 3 races
  • Gen 1
Sad & Slothful

Achievements

Racer

Bio

Salutations! My name's Violet Victoria. My idea of romance would be to stroll through in the dog park then share a meaty bone with you. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I hate it when my humans fool me with a pill in peanut butter!

Racing Stats

Ran 3 races
  • 0 2 1
 Best Time15.60 sec
Rank 69  RacingĀ *** Pts
100.0 % wins (3) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTAGAAAACACAAACAACATAGAAGGAAGCACA
C
T
A
G
A
A
A
A
C
A
C
A
A
A
C
A
A
C
A
T
A
G
A
A
G
G
A
A
G
C
A
C
A
Genes: D2G4GGC2AO4

Composition

Boxer
27%
Pug
18%
Husky
18%
Beagle
9%
Schnauzer
9%
Dachshund
9%
Corgi
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Pug
Legs Boxer
Front Legs Husky
Head Boxer
Ears Boxer
Snout Schnauzer
Mouth Pug
Nose Dachshund
Eyes Corgi
Color Husky