Missie Milo Litecoin Game Dog - Mix of Boxer, Labrador BK, Schnauzer, Beagle, Pitbull terrier, Dachshund, Corgi and Husky

Achievements

Racer
Missie Milo
I've been looking for love in all the wrong places... Power outages and computer viruses scare me! My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! Getting out of a long relationship, not looking for another
  • Purity 6%
  • Age 26 months
  • Racing Exp 29
  • Boxer 18%
  • 11 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 3 0
11 races    Best Time15.85 sec
No rank  Racing *** Coins
27.3 % wins (3) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CTATCCAACGCAAACATAATAGCAGGAAGCACA
C
T
A
T
C
C
A
A
C
G
C
A
A
A
C
A
T
A
A
T
A
G
C
A
G
G
A
A
G
C
A
C
A
Genes: DNG6GCC6AO4

Composition

Boxer
18%
Labrador BK
18%
Schnauzer
18%
Beagle
9%
Pitbull terrier
9%
Dachshund
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -43 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail Pitbull terrier
Legs Boxer
Front Legs Labrador BK
Head Boxer
Ears Schnauzer
Snout Schnauzer
Mouth Labrador BK
Nose Dachshund
Eyes Corgi
Color Husky