Indy Ibby Bitcoin Dog - Mix of Shiba Inu, Schnauzer, Boxer, Labrador BK, Labrador, Corgi and Husky

Achievements

None
Indy Ibby
Barkjour mi amor! I'm Indy Ibby. I pee when I'm excited. Power outages and computer viruses scare me! I prefer lounging around the house. Nothing beats the midday sunbeam on the couch! Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays.
  • Purity 12%
  • Age 21 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAATAAACGCAGTAGTAATAGTACCAAGCACA
G
T
A
A
T
A
A
A
C
G
C
A
G
T
A
G
T
A
A
T
A
G
T
A
C
C
A
A
G
C
A
C
A
Genes: ECG6EECE5O4

Composition

Shiba Inu
36%
Schnauzer
18%
Boxer
9%
Labrador BK
9%
Labrador
9%
Corgi
9%
Husky
9%

Current Energy

Vitality -23 points
Lunar Effect +6 points

Traits Breakdown

Body Shiba Inu
Tail Schnauzer
Legs Boxer
Front Legs Labrador BK
Head Shiba Inu
Ears Shiba Inu
Snout Schnauzer
Mouth Shiba Inu
Nose Labrador
Eyes Corgi
Color Husky