Slink Shoe String Bitcoin Game Dog - Mix of Dachshund, Labrador, Boxer, Labrador BK, Yorkshire Terrier, Shiba Inu, Golder Retriever and Husky
Slink Shoe String
  • Purity 11%
  • Age 18 months
  • Racing Exp 96
  • Dachshund 36%
  • Gold medal 4 Silver medal 3 Bronze medal 4
  • 30 races
  • Gen 2
Depressed & Snaillike

Achievements

Racer
Podium Champion
Master Champion

Bio

How do you do? I'm Slink Shoe String. In the big data server, I sorta rule. I don't understand why I like smelling butts... My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I hate having to share my food dish...

Racing Stats

Ran 30 races
  • 4 3 4
 Best Time15.00 sec
No rank  RacingĀ *** Pts
36.7 % wins (11) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGAAACGCATTAGGAGTAGGAGGAAGAACA
C
C
A
G
G
A
A
A
C
G
C
A
T
T
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
A
C
A
Genes: 5AG6FAEAA84

Composition

Dachshund
36%
Labrador
9%
Boxer
9%
Labrador BK
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Golder Retriever
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect +14 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Boxer
Front Legs Labrador BK
Head Yorkshire Terrier
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Husky