Slink Shoe String Bitcoin Game Dog - Mix of Dachshund, Labrador, Boxer, Labrador BK, Yorkshire Terrier, Shiba Inu, Golder Retriever and Husky

Achievements

Racer
Podium Champion
Master Champion
Slink Shoe String
How do you do? I'm Slink Shoe String. In the big data server, I sorta rule. I don't understand why I like smelling butts... My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I hate having to share my food dish...
  • Purity 11%
  • Age 21 months
  • Racing Exp 88
  • Dachshund 36%
  • 27 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 4 3 3
27 races    Best Time15.00 sec
No rank  Racing *** Coins
37.0 % wins (10) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: CCAGGAAACGCATTAGGAGTAGGAGGAAGAACA
C
C
A
G
G
A
A
A
C
G
C
A
T
T
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
A
C
A
Genes: 5AG6FAEAA84

Composition

Dachshund
36%
Labrador
9%
Boxer
9%
Labrador BK
9%
Yorkshire Terrier
9%
Shiba Inu
9%
Golder Retriever
9%
Husky
9%

Current Energy

Vitality -21 points
Lunar Effect -14 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Boxer
Front Legs Labrador BK
Head Yorkshire Terrier
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Husky