Jada Jock Cryptocurrency Dog - Mix of Dachshund, Labrador, Beagle, Labrador BK, Shiba Inu and Golder Retriever

Achievements

Racer
Jada Jock
I am a guard dog for the data warehouse. My 'G' spot is under my chin...scratch me there and I'll growl softly. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My human is my best friend, looking for someone who is okay with that.
  • Purity 25%
  • Age 21 months
  • Racing Exp 13
  • Dachshund 55%
  • 3 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 2
3 races    Best Time16.13 sec
No rank  Racing *** Coins
66.7 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGGACTAGCAGGAGGAGTAGGAGGAAGAGGA
C
C
A
G
G
A
C
T
A
G
C
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 5AD6AAEAA8A

Composition

Dachshund
55%
Labrador
9%
Beagle
9%
Labrador BK
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Beagle
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund