Jada Jock Cryptocurrency Dog - Mix of Dachshund, Labrador, Beagle, Labrador BK, Shiba Inu and Golder Retriever
Jada Jock
  • Purity 25%
  • Age 18 months
  • Racing Exp 16
  • Dachshund 55%
  • Gold medal 0 Silver medal 0 Bronze medal 2
  • 6 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

I am a guard dog for the data warehouse. My 'G' spot is under my chin...scratch me there and I'll growl softly. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My human is my best friend, looking for someone who is okay with that.

Racing Stats

Ran 6 races
  • 0 0 2
 Best Time16.13 sec
No rank  RacingĀ *** Pts
33.3 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCAGGACTAGCAGGAGGAGTAGGAGGAAGAGGA
C
C
A
G
G
A
C
T
A
G
C
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 5AD6AAEAA8A

Composition

Dachshund
55%
Labrador
9%
Beagle
9%
Labrador BK
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -26 points
Lunar Effect 0 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs Beagle
Front Legs Labrador BK
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund