Avril Amethyst Cryptocurrency Dog - Mix of Dachshund, Border Collie, German Shepard, Beagle and Grey Wolf

Achievements

None
Avril Amethyst
It doesn't matter to me which team I play for... I just like tail. Steak is my absolute favorite, but I prefer to eat chicken for my health. I love it when you show a little teeth. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!!
  • Purity 29%
  • Age 26 months
  • Racing Exp 0
  • Dachshund 55%
  • 0 races
  • Gen 3
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTCACTAGGAGGAGGACCCGGAGGATACGGA
T
A
C
T
C
A
C
T
A
G
G
A
G
G
A
G
G
A
C
C
C
G
G
A
G
G
A
T
A
C
G
G
A
Genes: J7DAAALAAJA

Composition

Dachshund
55%
Border Collie
18%
German Shepard
9%
Beagle
9%
Grey Wolf
9%

Current Energy

Vitality -37 points
Lunar Effect -18 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Beagle
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Grey Wolf
Mouth Dachshund
Nose Dachshund
Eyes Border Collie
Color Dachshund