Longo Doggo Legolas Litecoin Game Dog - Mix of Grey Wolf, Dachshund, Border Collie, German Shepard, Beagle, French Bulldog and Pitbull terrier

Achievements

None
Longo Doggo Legolas
How you doin? ;) Longo Doggo Legolas here. Grumpy Cat's grumpy because she knows virtual dogs like me are better than internet cat sensations. I love connecting with my friends via pee-mail. I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 9%
  • Age 31 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCACTAGGAGGACGACCCTACCCCTACTCC
C
C
C
T
C
A
C
T
A
G
G
A
G
G
A
C
G
A
C
C
C
T
A
C
C
C
C
T
A
C
T
C
C
Genes: L7DAA9LJLJN

Composition

Grey Wolf
27%
Dachshund
18%
Border Collie
18%
German Shepard
9%
Beagle
9%
French Bulldog
9%
Pitbull terrier
9%

Current Energy

Vitality -39 points
Lunar Effect -12 points

Traits Breakdown

Body Grey Wolf
Tail German Shepard
Legs Beagle
Front Legs Dachshund
Head Dachshund
Ears French Bulldog
Snout Grey Wolf
Mouth Border Collie
Nose Grey Wolf
Eyes Border Collie
Color Pitbull terrier