Domino Dinky Cryptocurrency Dog - Mix of Grey Wolf, Husky, Border Collie, Rottweiler and Dachshund

Achievements

Racer
Domino Dinky
Good day to you! I'm Domino Dinky! Ima cyber dog. Fences are just challenges...I don't let them stop me! It doesn't matter to me which team I play for... I just like tail. I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 15%
  • Age 26 months
  • Racing Exp 1
  • Grey Wolf 36%
  • 1 races
  • Gen 2
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

1 races   |
  • 0 0 0
 Best Time16.37 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCACACAGGACCCACACCCTACCCCTACACA
C
C
C
C
A
C
A
C
A
G
G
A
C
C
C
A
C
A
C
C
C
T
A
C
C
C
C
T
A
C
A
C
A
Genes: LH4AL4LJLJ4

Composition

Grey Wolf
36%
Husky
27%
Border Collie
18%
Rottweiler
9%
Dachshund
9%

Current Energy

Vitality -13 points
Lunar Effect -14 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Husky
Front Legs Dachshund
Head Grey Wolf
Ears Husky
Snout Grey Wolf
Mouth Border Collie
Nose Grey Wolf
Eyes Border Collie
Color Husky