Aigis Adele Litecoin Game Dog - Mix of Labrador, Border Collie, Grey Wolf, Pug, Rottweiler, Dachshund, Corgi and St. Bernard

Achievements

Racer
Podium Champion
Master Champion
Aigis Adele
I'd like to leave my paw prints in the sand next to yours on a moonlit beach. Sometimes I just have to roll in something dead. I'm sick of having my nails clipped, those are to help me dig! I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 9%
  • Age 18 months
  • Racing Exp 88
  • Labrador 27%
  • 27 races
  • Gen 5
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

27 races   |
  • 2 2 7
 Best Time15.13 sec
No rank  Racing *** Pts
40.7 % wins (11) Breeding *** Pts
Scheduled races 1 Total *** Pts

DNA Analysis

DNA Sequence: CCCGAACCACCACCACACGGATACAGCTACTGA
C
C
C
G
A
A
C
C
A
C
C
A
C
C
A
C
A
C
G
G
A
T
A
C
A
G
C
T
A
C
T
G
A
Genes: L2555HAJOJB

Composition

Labrador
27%
Border Collie
18%
Grey Wolf
9%
Pug
9%
Rottweiler
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality +1 points
Lunar Effect -8 points

Traits Breakdown

Body Grey Wolf
Tail Pug
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Rottweiler
Snout Dachshund
Mouth Border Collie
Nose Corgi
Eyes Border Collie
Color St. Bernard