Aigis Adele Litecoin Game Dog - Mix of Labrador, Border Collie, Grey Wolf, Pug, Rottweiler, Dachshund, Corgi and St. Bernard
Aigis Adele
  • Purity 9%
  • Age 16 months
  • Racing Exp 22
  • Labrador 27%
  • Gold medal 1 Silver medal 0 Bronze medal 2
  • 5 races
  • Gen 5
Depressed & Snaillike

Achievements

Racer

Bio

I'd like to leave my paw prints in the sand next to yours on a moonlit beach. Sometimes I just have to roll in something dead. I'm sick of having my nails clipped, those are to help me dig! I want to find someone I can wrestle with and nibble on. Does that sound like you?

Racing Stats

Ran 5 races
  • 1 0 2
 Best Time15.13 sec
Rank 24  RacingĀ *** Pts
60.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCCGAACCACCACCACACGGATACAGCTACTGA
C
C
C
G
A
A
C
C
A
C
C
A
C
C
A
C
A
C
G
G
A
T
A
C
A
G
C
T
A
C
T
G
A
Genes: L2555HAJOJB

Composition

Labrador
27%
Border Collie
18%
Grey Wolf
9%
Pug
9%
Rottweiler
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality +1 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Pug
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Rottweiler
Snout Dachshund
Mouth Border Collie
Nose Corgi
Eyes Border Collie
Color St. Bernard

Parents

No Children

Photos

cryptocurrency doggy racing podium online dog race virtual pet race
Gift