Coconut Cobweb Bitcoin Dog - Mix of Labrador, French Bulldog, Pug, Rottweiler, Dachshund, Corgi and St. Bernard
Coconut Cobweb
  • Purity 11%
  • Age 15 months
  • Racing Exp 4
  • Labrador 27%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 4 races
  • Gen 4
Depressed & Snaillike

Achievements

Racer

Bio

Hey, good-looking! This is Coconut Cobweb. Let me have a pig's ear and I'm in heaven. The place I like most in the world is curled up in my human's bed, hogging all the covers! I'm always up for some puppy action, is that wrong? I don't understand why my human tries to give me tap water. I expect filtered and distilled!

Racing Stats

Ran 4 races
  • 0 0 0
 Best Time15.87 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CGAGAACCACCACCACACGGAGAAAGCCGATGA
C
G
A
G
A
A
C
C
A
C
C
A
C
C
A
C
A
C
G
G
A
G
A
A
A
G
C
C
G
A
T
G
A
Genes: 92555HA2O9B

Composition

Labrador
27%
French Bulldog
18%
Pug
18%
Rottweiler
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect -10 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Rottweiler
Snout Dachshund
Mouth Pug
Nose Corgi
Eyes French Bulldog
Color St. Bernard