Coconut Cobweb Bitcoin Dog - Mix of Labrador, French Bulldog, Pug, Rottweiler, Dachshund, Corgi and St. Bernard

Achievements

Racer
Coconut Cobweb
Hey, good-looking! This is Coconut Cobweb. Let me have a pig's ear and I'm in heaven. The place I like most in the world is curled up in my human's bed, hogging all the covers! I'm always up for some puppy action, is that wrong? I don't understand why my human tries to give me tap water. I expect filtered and distilled!
  • Purity 11%
  • Age 21 months
  • Racing Exp 4
  • Labrador 27%
  • 4 races
  • Gen 4
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time15.87 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGAGAACCACCACCACACGGAGAAAGCCGATGA
C
G
A
G
A
A
C
C
A
C
C
A
C
C
A
C
A
C
G
G
A
G
A
A
A
G
C
C
G
A
T
G
A
Genes: 92555HA2O9B

Composition

Labrador
27%
French Bulldog
18%
Pug
18%
Rottweiler
9%
Dachshund
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality -21 points
Lunar Effect -6 points

Traits Breakdown

Body French Bulldog
Tail Pug
Legs Labrador
Front Legs Labrador
Head Labrador
Ears Rottweiler
Snout Dachshund
Mouth Pug
Nose Corgi
Eyes French Bulldog
Color St. Bernard