Bessie Betsy Crypto Dog - Mix of Grey Wolf, Husky, Pitbull terrier, Rottweiler, Shiba Inu and Border Collie

Achievements

None
Bessie Betsy
Yo! I'm Bessie Betsy and I'd like to rock your world. I've always wanted to be in commercials and be treated as the star I am! My favorite way to spend playtime is a good game of frisbee. I don't like having to stay off the furniture. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew.
  • Purity 21%
  • Age 29 months
  • Racing Exp 0
  • Grey Wolf 45%
  • 0 races
  • Gen 3
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCCACCCCCCCGTAACACCCCCCCCCTACACA
T
C
C
C
A
C
C
C
C
C
C
C
G
T
A
A
C
A
C
C
C
C
C
C
C
C
C
T
A
C
A
C
A
Genes: NHLLE4LLLJ4

Composition

Grey Wolf
45%
Husky
18%
Pitbull terrier
9%
Rottweiler
9%
Shiba Inu
9%
Border Collie
9%

Current Energy

Vitality -6 points
Lunar Effect -12 points

Traits Breakdown

Body Pitbull terrier
Tail Rottweiler
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Husky
Snout Grey Wolf
Mouth Grey Wolf
Nose Grey Wolf
Eyes Border Collie
Color Husky