Butternut Boo Cryptocurrency Dog - Mix of Grey Wolf, Pitbull terrier, Maltese, Shiba Inu and Labrador BK

Achievements

None
Butternut Boo
I live in cyberspace. I hate having to wear foo-foo clothes and ribbons in my fur. I adore sleeping upside down with my tongue hanging out! My favorite place to sleep is under the covers between my humans. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 20%
  • Age 28 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCCCCCCCGTACCCGCACCCTCCACCACC
T
C
C
T
C
C
C
C
C
C
C
C
G
T
A
C
C
C
G
C
A
C
C
C
T
C
C
A
C
C
A
C
C
Genes: NNLLEL6LNKK

Composition

Grey Wolf
36%
Pitbull terrier
27%
Maltese
18%
Shiba Inu
9%
Labrador BK
9%

Current Energy

Vitality -19 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Grey Wolf
Front Legs Grey Wolf
Head Shiba Inu
Ears Grey Wolf
Snout Labrador BK
Mouth Grey Wolf
Nose Pitbull terrier
Eyes Maltese
Color Maltese