Varys Viva Litecoin Dog - Mix of Pitbull terrier, Maltese, Shiba Inu, Grey Wolf, St. Bernard, Rottweiler and Schnauzer

Achievements

None
Varys Viva
Hey! Call me Varys Viva. I usually spend my days protecting my yard from those pesky squirrels. I don't know what it is, but I know they're up to no good... Fences are just challenges...I don't let them stop me! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him!
  • Purity 14%
  • Age 26 months
  • Racing Exp 0
  • Pitbull terrier 36%
  • 0 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCCTCCCCCTGATCCCACTCCATAACCACC
G
T
A
T
C
C
T
C
C
C
C
C
T
G
A
T
C
C
C
A
C
T
C
C
A
T
A
A
C
C
A
C
C
Genes: ENNLBNHNCKK

Composition

Pitbull terrier
36%
Maltese
18%
Shiba Inu
9%
Grey Wolf
9%
St. Bernard
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -30 points
Lunar Effect +10 points

Traits Breakdown

Body Shiba Inu
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Grey Wolf
Head St. Bernard
Ears Pitbull terrier
Snout Rottweiler
Mouth Pitbull terrier
Nose Schnauzer
Eyes Maltese
Color Maltese