Olivia Offense Litecoin Dog - Mix of Pitbull terrier, Rottweiler, Shiba Inu, St. Bernard, Schnauzer and Boxer

Achievements

None
Olivia Offense
Hey there! Baby, call me Olivia Offense. I'm a super-dog in the internet universe. I love connecting with my friends via pee-mail. My female human wears crotchless undies, but she doesn't like the ones I make for her! I'm looking to share time together and not just to be an accessory.
  • Purity 20%
  • Age 26 months
  • Racing Exp 0
  • Pitbull terrier 45%
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GTATCCTCCTCCTGATCCCACTCCATAAACCAC
G
T
A
T
C
C
T
C
C
T
C
C
T
G
A
T
C
C
C
A
C
T
C
C
A
T
A
A
A
C
C
A
C
Genes: ENNNBNHNCGH

Composition

Pitbull terrier
45%
Rottweiler
18%
Shiba Inu
9%
St. Bernard
9%
Schnauzer
9%
Boxer
9%

Current Energy

Vitality -45 points
Lunar Effect 0 points

Traits Breakdown

Body Shiba Inu
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Pitbull terrier
Head St. Bernard
Ears Pitbull terrier
Snout Rottweiler
Mouth Pitbull terrier
Nose Schnauzer
Eyes Boxer
Color Rottweiler