Donald Duck Dandy

Sup? ;-) I'm Donald Duck Dandy. I'm sick of having my nails clipped, those are to help me dig! I really enjoy heavy petting. Spiked dog collars really turn me on. In my humble opinion the best toy is one of my human's stinky, old socks. I'm hoping to find someone who'll howl at the moon with me.

Purity 6%
Age 21 months
Racing Exp 9

Border Collie 18%
2 races
Gen 1

Depressed & Snaillike

Energy: ▂▃▅▆▇

Racing Stats

1 0 0


2 races	Best Time	16.93 sec
No rank	Racing	*** Coins
50.0 % wins (1)	Breeding	*** Coins
Scheduled races 0	Total	*** Coins

DNA Analysis

DNA Sequence: TACGCAACACTAAGCTACTCCCCATCCACCACC

Genes: J64DOJN5NKK

Composition

Border Collie	18%
Pitbull terrier	18%
Maltese	18%
Labrador BK	9%
Husky	9%
Beagle	9%
Corgi	9%
Labrador	9%

Current Energy

Vitality	-39 points
Lunar Effect	+6 points

Traits Breakdown

Body	Border Collie
Tail	Labrador BK
Legs	Husky
Front Legs	Beagle
Head	Corgi
Ears	Border Collie
Snout	Pitbull terrier
Mouth	Labrador
Nose	Pitbull terrier
Eyes	Maltese
Color	Maltese

Parents

Wizard Wyatt

Butternut Boo

Children

Ozzie Ozzy

Corky Cutie

Sebastian Star

Photos

Achievements