Donald Duck Dandy Litecoin Dog - Mix of Border Collie, Pitbull terrier, Maltese, Labrador BK, Husky, Beagle, Corgi and Labrador
Donald Duck Dandy
  • Purity 6%
  • Age 13 months
  • Racing Exp 1
  • Border Collie 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

Sup? ;-) I'm Donald Duck Dandy. I'm sick of having my nails clipped, those are to help me dig! I really enjoy heavy petting. Spiked dog collars really turn me on. In my humble opinion the best toy is one of my human's stinky, old socks. I'm hoping to find someone who'll howl at the moon with me.

Racing Stats

Ran 1 races
  • 0 0 0
 Best Time17.07 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACGCAACACTAAGCTACTCCCCATCCACCACC
T
A
C
G
C
A
A
C
A
C
T
A
A
G
C
T
A
C
T
C
C
C
C
A
T
C
C
A
C
C
A
C
C
Genes: J64DOJN5NKK

Composition

Border Collie
18%
Pitbull terrier
18%
Maltese
18%
Labrador BK
9%
Husky
9%
Beagle
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality -39 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Husky
Front Legs Beagle
Head Corgi
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Pitbull terrier
Eyes Maltese
Color Maltese