Donald Duck Dandy Litecoin Dog - Mix of Border Collie, Pitbull terrier, Maltese, Labrador BK, Husky, Beagle, Corgi and Labrador

Achievements

Racer
Donald Duck Dandy
Sup? ;-) I'm Donald Duck Dandy. I'm sick of having my nails clipped, those are to help me dig! I really enjoy heavy petting. Spiked dog collars really turn me on. In my humble opinion the best toy is one of my human's stinky, old socks. I'm hoping to find someone who'll howl at the moon with me.
  • Purity 6%
  • Age 21 months
  • Racing Exp 9
  • Border Collie 18%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 1 0 0
2 races    Best Time16.93 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TACGCAACACTAAGCTACTCCCCATCCACCACC
T
A
C
G
C
A
A
C
A
C
T
A
A
G
C
T
A
C
T
C
C
C
C
A
T
C
C
A
C
C
A
C
C
Genes: J64DOJN5NKK

Composition

Border Collie
18%
Pitbull terrier
18%
Maltese
18%
Labrador BK
9%
Husky
9%
Beagle
9%
Corgi
9%
Labrador
9%

Current Energy

Vitality -39 points
Lunar Effect +6 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Husky
Front Legs Beagle
Head Corgi
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Pitbull terrier
Eyes Maltese
Color Maltese