Wizard Wyatt Bitcoin Game Dog - Mix of Border Collie, Husky, Labrador BK, Beagle, Corgi, Pitbull terrier, Labrador, Grey Wolf and Shiba Inu
Wizard Wyatt
  • Purity 3%
  • Age 15 months
  • Racing Exp 8
  • Border Collie 18%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 1 races
  • Gen 0
Depressed & Snaillike

Achievements

Racer

Bio

Chasing anything that will run is so much fun, I could do that all day. I love it when you show a little teeth. I'm the best at running circle 8's. I hate it when my humans fart and they blame me! If you are tall enough to reach the door handle, I 'specially wanna meet you.

Racing Stats

Ran 1 races
  • 1 0 0
 Best Time15.88 sec
No rank  RacingĀ *** Pts
100.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACGCAACACTAAGCTACTCCCCACCCACAGTA
T
A
C
G
C
A
A
C
A
C
T
A
A
G
C
T
A
C
T
C
C
C
C
A
C
C
C
A
C
A
G
T
A
Genes: J64DOJN5L4E

Composition

Border Collie
18%
Husky
18%
Labrador BK
9%
Beagle
9%
Corgi
9%
Pitbull terrier
9%
Labrador
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality -34 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail Labrador BK
Legs Husky
Front Legs Beagle
Head Corgi
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Grey Wolf
Eyes Husky
Color Shiba Inu