Sonya Blade Squat Crypto Game Dog - Mix of Pitbull terrier, Border Collie, German Shepard, Maltese, Corgi, Labrador, Grey Wolf and Shiba Inu
Sonya Blade Squat
  • Purity 6%
  • Age 15 months
  • Racing Exp 9
  • Pitbull terrier 27%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 1
Depressed & Snaillike

Achievements

Racer

Bio

I like giving wet kisses. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Those flying monkeys in the Wizard of Oz still scare me! I am looking for my best friend, lover, and equal partner to share my food bowl.

Racing Stats

Ran 3 races
  • 0 1 0
 Best Time16.07 sec
No rank  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TACTCATCCACCAGCTACTCCCCACCCTCCGTA
T
A
C
T
C
A
T
C
C
A
C
C
A
G
C
T
A
C
T
C
C
C
C
A
C
C
C
T
C
C
G
T
A
Genes: J7NKOJN5LNE

Composition

Pitbull terrier
27%
Border Collie
18%
German Shepard
9%
Maltese
9%
Corgi
9%
Labrador
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality -54 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Pitbull terrier
Front Legs Maltese
Head Corgi
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Grey Wolf
Eyes Pitbull terrier
Color Shiba Inu

Parents

No Children

Photos

crypto pet race photo
Gift