Sonya Blade Squat Crypto Game Dog - Mix of Pitbull terrier, Border Collie, German Shepard, Maltese, Corgi, Labrador, Grey Wolf and Shiba Inu

Achievements

Racer
Sonya Blade Squat
I like giving wet kisses. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. Those flying monkeys in the Wizard of Oz still scare me! I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 6%
  • Age 18 months
  • Racing Exp 21
  • Pitbull terrier 27%
  • 9 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 0 2 0
 Best Time16.07 sec
No rank  Racing *** Pts
22.2 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TACTCATCCACCAGCTACTCCCCACCCTCCGTA
T
A
C
T
C
A
T
C
C
A
C
C
A
G
C
T
A
C
T
C
C
C
C
A
C
C
C
T
C
C
G
T
A
Genes: J7NKOJN5LNE

Composition

Pitbull terrier
27%
Border Collie
18%
German Shepard
9%
Maltese
9%
Corgi
9%
Labrador
9%
Grey Wolf
9%
Shiba Inu
9%

Current Energy

Vitality -54 points
Lunar Effect -4 points

Traits Breakdown

Body Border Collie
Tail German Shepard
Legs Pitbull terrier
Front Legs Maltese
Head Corgi
Ears Border Collie
Snout Pitbull terrier
Mouth Labrador
Nose Grey Wolf
Eyes Pitbull terrier
Color Shiba Inu

Parents

No Children

Photos

cryptocurrency dog racing photo crypto dog racing