Lollipop Latte Crypto Dog - Mix of Pitbull terrier, Beagle, German Shepard, Maltese, Poodle, Labrador, Corgi, Husky, Dachshund and French Bulldog
Lollipop Latte
  • Purity 1%
  • Age 34 months
  • Racing Exp 5
  • Pitbull terrier 18%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 5 races
  • Gen 0
Neutral & Tardy

Achievements

Racer

Bio

I am a guard dog for the data warehouse. After introductory sniffing, I like some licking. I've been known to run with bad dogs. I hate it when other dogs pee in my yard! IT'S MY YARD!! My favorite position is doggie style ;)

Racing Stats

Ran 5 races
  • 0 0 0
 Best Time15.97 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CTATCATCCACCGACCCAAGCACAGGATCCCGA
C
T
A
T
C
A
T
C
C
A
C
C
G
A
C
C
C
A
A
G
C
A
C
A
G
G
A
T
C
C
C
G
A
Genes: D7NKI5O4AN9

Composition

Pitbull terrier
18%
Beagle
9%
German Shepard
9%
Maltese
9%
Poodle
9%
Labrador
9%
Corgi
9%
Husky
9%
Dachshund
9%
French Bulldog
9%

Current Energy

Vitality -65 points
Lunar Effect -8 points

Traits Breakdown

Body Beagle
Tail German Shepard
Legs Pitbull terrier
Front Legs Maltese
Head Poodle
Ears Labrador
Snout Corgi
Mouth Husky
Nose Dachshund
Eyes Pitbull terrier
Color French Bulldog