Ozzie Ozzy Cryptocurrency Game Dog - Mix of Labrador, Border Collie, Pitbull terrier and Maltese

Achievements

Racer
Ozzie Ozzy
My name is Ozzie Ozzy and I'd really like to sniff you. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I enjoy staying active, and running circles around puppies and young children. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.
  • Purity 34%
  • Age 21 months
  • Racing Exp 8
  • Labrador 55%
  • 3 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time16.07 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCACCACCACCATACTACCCACCATCCACCTCC
C
C
A
C
C
A
C
C
A
C
C
A
T
A
C
T
A
C
C
C
A
C
C
A
T
C
C
A
C
C
T
C
C
Genes: 5555JJ55NKN

Composition

Labrador
55%
Border Collie
18%
Pitbull terrier
18%
Maltese
9%

Current Energy

Vitality +1 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Border Collie
Ears Border Collie
Snout Labrador
Mouth Labrador
Nose Pitbull terrier
Eyes Maltese
Color Pitbull terrier