Ozzie Ozzy Cryptocurrency Game Dog - Mix of Labrador, Border Collie, Pitbull terrier and Maltese
Ozzie Ozzy
  • Purity 34%
  • Age 13 months
  • Racing Exp 2
  • Labrador 55%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

My name is Ozzie Ozzy and I'd really like to sniff you. Trust me. Leashes, collar and whips can be fun if you know what you're doing. I enjoy staying active, and running circles around puppies and young children. Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.07 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: CCACCACCACCATACTACCCACCATCCACCTCC
C
C
A
C
C
A
C
C
A
C
C
A
T
A
C
T
A
C
C
C
A
C
C
A
T
C
C
A
C
C
T
C
C
Genes: 5555JJ55NKN

Composition

Labrador
55%
Border Collie
18%
Pitbull terrier
18%
Maltese
9%

Current Energy

Vitality +1 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador
Tail Labrador
Legs Labrador
Front Legs Labrador
Head Border Collie
Ears Border Collie
Snout Labrador
Mouth Labrador
Nose Pitbull terrier
Eyes Maltese
Color Pitbull terrier

Parents

No Children

Photos

Gift