Digby Dart Litecoin Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Digby Dart
  • Purity 65%
  • Age 18 months
  • Racing Exp 21
  • Dachshund 82%
  • Gold medal 0 Silver medal 0 Bronze medal 3
  • 6 races
  • Gen 6
Depressed & Snaillike

Achievements

Racer

Bio

Pleased to meet you! My name's Digby Dart. I work in The Virtual Machine. The smell of fresh manure to roll in makes me wild. I'm always up for a nice long walk around the neighborhood. The place I like most in the world is curled up in my human's bed, hogging all the covers!

Racing Stats

Ran 6 races
  • 0 0 3
 Best Time15.52 sec
No rank  RacingĀ *** Pts
50.0 % wins (3) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund