Digby Dart Litecoin Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Digby Dart
Pleased to meet you! My name's Digby Dart. I work in The Virtual Machine. The smell of fresh manure to roll in makes me wild. I'm always up for a nice long walk around the neighborhood. The place I like most in the world is curled up in my human's bed, hogging all the covers!
  • Purity 65%
  • Age 22 months
  • Racing Exp 3
  • Dachshund 82%
  • 3 races
  • Gen 6
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
3 races    Best Time15.52 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund