Mulligan Miles Crypto Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Mulligan Miles
Halloween costumes are the worst, I hate 'em! I'll eat my vomit and yours too. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! If you enjoy growling through fences as much as I do, we should get together.
  • Purity 65%
  • Age 21 months
  • Racing Exp 8
  • Dachshund 82%
  • 3 races
  • Gen 7
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 1
3 races    Best Time15.83 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund