Mulligan Miles Crypto Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Mulligan Miles
  • Purity 65%
  • Age 18 months
  • Racing Exp 17
  • Dachshund 82%
  • Gold medal 0 Silver medal 1 Bronze medal 1
  • 6 races
  • Gen 7
Depressed & Snaillike

Achievements

Racer

Bio

Halloween costumes are the worst, I hate 'em! I'll eat my vomit and yours too. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite! If you enjoy growling through fences as much as I do, we should get together.

Racing Stats

Ran 6 races
  • 0 1 1
 Best Time15.83 sec
No rank  RacingĀ *** Pts
33.3 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund