Isabella Isabella Bitcoin Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Isabella Isabella
This dawg chases mice in a big data warehouse. Fences are just challenges...I don't let them stop me! I love fetching anything my human throws! I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...
  • Purity 65%
  • Age 22 months
  • Racing Exp 17
  • Dachshund 82%
  • 4 races
  • Gen 8
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 1 1 0
4 races    Best Time15.50 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund