Isabella Isabella Bitcoin Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Isabella Isabella
  • Purity 65%
  • Age 16 months
  • Racing Exp 10
  • Dachshund 82%
  • Gold medal 1 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

This dawg chases mice in a big data warehouse. Fences are just challenges...I don't let them stop me! I love fetching anything my human throws! I'm tired of barking up the wrong trees! Seriously, my ball is stuck in a tree and I need someone to help me get it...

Racing Stats

Ran 3 races
  • 1 0 0
 Best Time15.50 sec
Rank 57  RacingĀ *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund