Dobby Dottie Crypto Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Dobby Dottie
  • Purity 65%
  • Age 16 months
  • Racing Exp 15
  • Dachshund 82%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 3 races
  • Gen 9
Depressed & Snaillike

Achievements

Racer

Bio

Yo dog! Dobby Dottie here. I run exclusively on code. Once I caught a seagull, but it scared me so I let it go. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm on the lookout for someone willing to stop and smell the catpoop with me.

Racing Stats

Ran 3 races
  • 0 2 0
 Best Time16.37 sec
No rank  RacingĀ *** Pts
66.7 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund