Dobby Dottie Crypto Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Dobby Dottie
Yo dog! Dobby Dottie here. I run exclusively on code. Once I caught a seagull, but it scared me so I let it go. I love digging. No particular reason, it just satisfies me to make a huge, muddy mess wherever I go. I'm on the lookout for someone willing to stop and smell the catpoop with me.
  • Purity 65%
  • Age 19 months
  • Racing Exp 20
  • Dachshund 82%
  • 8 races
  • Gen 9
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

8 races   |
  • 0 2 0
 Best Time16.37 sec
No rank  Racing *** Pts
25.0 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund