Cobra Camille Digital Cryptocurrency Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Cobra Camille
Howdy! I'm Cobra Camille. The Ethernet where I live, rocks. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I love cuddling up, doggy-style after a romantic evening. Hope you like the smell of wet fur, because I'll jump into any water I see!
  • Purity 65%
  • Age 23 months
  • Racing Exp 7
  • Dachshund 82%
  • 2 races
  • Gen 12
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

2 races   |
  • 0 0 1
 Best Time16.75 sec
No rank  Racing *** Coins
50.0 % wins (1) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund