Cobra Camille Digital Cryptocurrency Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Cobra Camille
  • Purity 65%
  • Age 14 months
  • Racing Exp 7
  • Dachshund 82%
  • Gold medal 0 Silver medal 0 Bronze medal 1
  • 2 races
  • Gen 12
Depressed & Snaillike

Achievements

Racer

Bio

Howdy! I'm Cobra Camille. The Ethernet where I live, rocks. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!! I love cuddling up, doggy-style after a romantic evening. Hope you like the smell of wet fur, because I'll jump into any water I see!

Racing Stats

Ran 2 races
  • 0 0 1
 Best Time16.75 sec
No rank  RacingĀ *** Pts
50.0 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund