Moon Marshmallow Litecoin Game Dog - Mix of Dachshund, German Shepard, Shiba Inu and Golder Retriever
Moon Marshmallow
  • Purity 50%
  • Age 17 months
  • Racing Exp 13
  • Dachshund 73%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 7 races
  • Gen 13
Depressed & Snaillike

Achievements

Racer

Bio

Top o' the mornin' to ya! I'm Moon Marshmallow. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. What's your favorite bed? Mine is the dirty laundry. Being able to lick myself is nice, but I want to find my special someone.

Racing Stats

Ran 7 races
  • 0 1 0
 Best Time15.52 sec
No rank  RacingĀ *** Pts
14.3 % wins (1) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
T
C
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 7AAAAAEAA8A

Composition

Dachshund
73%
German Shepard
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect +22 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund