Moon Marshmallow Litecoin Game Dog - Mix of Dachshund, German Shepard, Shiba Inu and Golder Retriever

Achievements

Racer
Moon Marshmallow
Top o' the mornin' to ya! I'm Moon Marshmallow. I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. What's your favorite bed? Mine is the dirty laundry. Being able to lick myself is nice, but I want to find my special someone.
  • Purity 50%
  • Age 21 months
  • Racing Exp 9
  • Dachshund 73%
  • 3 races
  • Gen 13
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 1 0
3 races    Best Time15.52 sec
No rank  Racing *** Coins
33.3 % wins (1) Breeding *** Coins
Scheduled races 1 Total *** Coins

DNA Analysis

DNA Sequence: TCAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
T
C
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 7AAAAAEAA8A

Composition

Dachshund
73%
German Shepard
9%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect -22 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund