Murray Marshmallow Cryptocurrency Dog - Mix of Dachshund, German Shepard, St. Bernard and Golder Retriever

Achievements

Racer
Podium Champion
Master Champion
Murray Marshmallow
Hi! My name is Murray Marshmallow. I make the best virtual pet. I'm going kill that damn Nyan Cat if I can catch it. I love fetching anything my human throws! As a designer, I suggest low windows or couch backs next to windows without curtains. I hate it when humans put the lid down.
  • Purity 50%
  • Age 19 months
  • Racing Exp 80
  • Dachshund 73%
  • 24 races
  • Gen 14
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

24 races   |
  • 1 4 5
 Best Time15.13 sec
No rank  Racing *** Pts
41.7 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
T
C
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: 7AAAAABAA8A

Composition

Dachshund
73%
German Shepard
9%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -33 points
Lunar Effect -22 points

Traits Breakdown

Body German Shepard
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund