Julia Jenna Litecoin Dog - Mix of Dachshund, St. Bernard and Golder Retriever

Achievements

Racer
Julia Jenna
Howdy potential partner! Julia Jenna here. As a designer, I suggest low windows or couch backs next to windows without curtains. I hate being left alone all day. My 'G' spot is under my chin...scratch me there and I'll growl softly. I'm ready to settle down and have puppies...what about you?
  • Purity 65%
  • Age 22 months
  • Racing Exp 4
  • Dachshund 82%
  • 4 races
  • Gen 11
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time16.47 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAABAA8A

Composition

Dachshund
82%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund