Julia Jenna Litecoin Dog - Mix of Dachshund, St. Bernard and Golder Retriever
Julia Jenna
  • Purity 65%
  • Age 16 months
  • Racing Exp 3
  • Dachshund 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 11
Depressed & Snaillike

Achievements

Racer

Bio

Howdy potential partner! Julia Jenna here. As a designer, I suggest low windows or couch backs next to windows without curtains. I hate being left alone all day. My 'G' spot is under my chin...scratch me there and I'll growl softly. I'm ready to settle down and have puppies...what about you?

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time16.47 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAABAA8A

Composition

Dachshund
82%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund