Thyme Tippy Bitcoin Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Thyme Tippy
I'm always up for some puppy action, is that wrong? I enjoy destroying a nice fresh pair of slippers. I hate not being allowed to hunt treasure in the garbage. It smells so good! I'm trying to find a partner in crime to help me dig through the trash for the good stuff.
  • Purity 65%
  • Age 19 months
  • Racing Exp 7
  • Dachshund 82%
  • 7 races
  • Gen 10
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 0 0 0
 Best Time15.60 sec
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund