Thyme Tippy Bitcoin Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Thyme Tippy
  • Purity 65%
  • Age 16 months
  • Racing Exp 2
  • Dachshund 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 2 races
  • Gen 10
Depressed & Snaillike

Achievements

Racer

Bio

I'm always up for some puppy action, is that wrong? I enjoy destroying a nice fresh pair of slippers. I hate not being allowed to hunt treasure in the garbage. It smells so good! I'm trying to find a partner in crime to help me dig through the trash for the good stuff.

Racing Stats

Ran 2 races
  • 0 0 0
 Best Time16.85 sec
No rank  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund