Mabel Murray Crypto Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Podium Champion
Mabel Murray
Hey, good-looking! This is Mabel Murray. Let me have a pig's ear and I'm in heaven. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I get a little upset when my human gets mad at me for redecorating the house. It took me hours to spread all of that pillow stuffing out on the floor and I thought it looked perfect! I've been solitary dog...looking for someone worth changing over.
  • Purity 65%
  • Age 19 months
  • Racing Exp 37
  • Dachshund 82%
  • 7 races
  • Gen 8
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

7 races   |
  • 2 1 2
 Best Time15.12 sec
No rank  Racing *** Pts
71.4 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund