Blackie Bitsy Crypto Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Blackie Bitsy
  • Purity 65%
  • Age 17 months
  • Racing Exp 114
  • Dachshund 82%
  • Gold medal 7 Silver medal 4 Bronze medal 2
  • 31 races
  • Gen 7
Depressed & Snaillike

Achievements

Pro Racer
Podium Champion
Master Champion

Bio

The Ethernet where I live, rocks. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm always up for a nice long walk around the neighborhood. Fences are just challenges...I don't let them stop me! I hate having to wear foo-foo clothes and ribbons in my fur.

Racing Stats

Ran 31 races
  • 7 4 2
 Best Time14.52 sec
No rank  RacingĀ *** Pts
41.9 % wins (13) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect 0 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund