Blackie Bitsy Crypto Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Pro Racer
Podium Champion
Master Champion
Blackie Bitsy
The Ethernet where I live, rocks. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. I'm always up for a nice long walk around the neighborhood. Fences are just challenges...I don't let them stop me! I hate having to wear foo-foo clothes and ribbons in my fur.
  • Purity 65%
  • Age 21 months
  • Racing Exp 111
  • Dachshund 82%
  • 28 races
  • Gen 7
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 7 4 2
28 races    Best Time14.52 sec
No rank  Racing *** Coins
46.4 % wins (13) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund