Freddy Fern Litecoin Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever
Freddy Fern
  • Purity 65%
  • Age 14 months
  • Racing Exp 3
  • Dachshund 82%
  • Gold medal 0 Silver medal 0 Bronze medal 0
  • 3 races
  • Gen 8
Depressed & Snaillike

Achievements

Racer

Bio

The Ethernet where I live, rocks. I am on a mission to sniff all the butts in the world. ALL the butts. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! My 'G' spot is under my chin...scratch me there and I'll growl softly.

Racing Stats

Ran 3 races
  • 0 0 0
 Best Time15.70 sec
Rank 81  RacingĀ *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +4 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund