Freddy Fern Litecoin Game Dog - Mix of Dachshund, Shiba Inu and Golder Retriever

Achievements

Racer
Freddy Fern
The Ethernet where I live, rocks. I am on a mission to sniff all the butts in the world. ALL the butts. If I had to pick a favorite food it would be a hot-dog, because you are what you eat! My 'G' spot is under my chin...scratch me there and I'll growl softly.
  • Purity 65%
  • Age 22 months
  • Racing Exp 4
  • Dachshund 82%
  • 4 races
  • Gen 8
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
4 races    Best Time15.70 sec
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGAGTAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
T
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAAEAA8A

Composition

Dachshund
82%
Shiba Inu
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout Shiba Inu
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund