T-Bone Tango Litecoin Dog - Mix of Dachshund, St. Bernard and Golder Retriever

Achievements

Pro Racer
T-Bone Tango
Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. If I can't reach it to clean it myself, it doesn't need cleaning! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I enjoy finding and eating frozen cat turds in the winter. Bon appétit!
  • Purity 65%
  • Age 19 months
  • Racing Exp 51
  • Dachshund 82%
  • 23 races
  • Gen 15
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

23 races   |
  • 0 3 2
 Best Time15.75 sec
No rank  Racing *** Pts
21.7 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAABAA8A

Composition

Dachshund
82%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect -24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund