T-Bone Tango Litecoin Dog - Mix of Dachshund, St. Bernard and Golder Retriever
T-Bone Tango
  • Purity 65%
  • Age 16 months
  • Racing Exp 9
  • Dachshund 82%
  • Gold medal 0 Silver medal 1 Bronze medal 0
  • 3 races
  • Gen 15
Depressed & Snaillike

Achievements

Racer

Bio

Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. If I can't reach it to clean it myself, it doesn't need cleaning! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I enjoy finding and eating frozen cat turds in the winter. Bon appétit!

Racing Stats

Ran 3 races
  • 0 1 0
 Best Time15.75 sec
Rank 86  Racing *** Pts
33.3 % wins (1) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAGGAGGAGGAGGAGGATGAGGAGGAAGAGGA
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
G
G
A
G
G
A
A
G
A
G
G
A
Genes: AAAAAABAA8A

Composition

Dachshund
82%
St. Bernard
9%
Golder Retriever
9%

Current Energy

Vitality -39 points
Lunar Effect +24 points

Traits Breakdown

Body Dachshund
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Dachshund
Nose Dachshund
Eyes Golder Retriever
Color Dachshund