Buzzy Brandy Crypto Game Dog - Mix of Dachshund, Pitbull terrier, St. Bernard, Labrador, Golder Retriever and Yorkshire Terrier

Achievements

Racer
Buzzy Brandy
You can call me Buzzy Brandy, everybody else does. I'm into recreational spankings and a little 'ruff' play. I am not above stealing food off humans' plates. My favorite treat is to steal the pepperoni off of pizza. New experiences? New treats? New places! Yes, please!
  • Purity 23%
  • Age 18 months
  • Racing Exp 39
  • Dachshund 45%
  • 11 races
  • Gen 16
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

11 races   |
  • 0 3 2
 Best Time15.47 sec
No rank  Racing *** Pts
45.5 % wins (5) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCCGGAGGAGGAGGAGGATGATCCCCAAGATTA
T
C
C
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
T
C
C
C
C
A
A
G
A
T
T
A
Genes: NAAAAABN58F

Composition

Dachshund
45%
Pitbull terrier
18%
St. Bernard
9%
Labrador
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect -12 points

Traits Breakdown

Body Pitbull terrier
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Pitbull terrier
Nose Labrador
Eyes Golder Retriever
Color Yorkshire Terrier