Buzzy Brandy Crypto Game Dog - Mix of Dachshund, Pitbull terrier, St. Bernard, Labrador, Golder Retriever and Yorkshire Terrier
Buzzy Brandy
  • Purity 23%
  • Age 51 months
  • Racing Exp 26
  • Dachshund 45%
  • Gold medal 0 Silver medal 2 Bronze medal 1
  • 9 races
  • Gen 16
Sad & Snaillike

Achievements

Racer

Bio

You can call me Buzzy Brandy, everybody else does. I'm into recreational spankings and a little 'ruff' play. I am not above stealing food off humans' plates. My favorite treat is to steal the pepperoni off of pizza. New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 9 races
  • 0 2 1
 Best Time15.47 sec
No rank  RacingĀ *** Pts
33.3% wins (3) Breeding *** Pts
Scheduled races 1 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCCGGAGGAGGAGGAGGATGATCCCCAAGATTA
T
C
C
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
T
C
C
C
C
A
A
G
A
T
T
A
Genes: NAAAAABN58F

Composition

Dachshund
45%
Pitbull terrier
18%
St. Bernard
9%
Labrador
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect +16 points

Traits Breakdown

Body Pitbull terrier
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Pitbull terrier
Nose Labrador
Eyes Golder Retriever
Color Yorkshire Terrier