Buzzy Brandy Crypto Game Dog - Mix of Dachshund, Pitbull terrier, St. Bernard, Labrador, Golder Retriever and Yorkshire Terrier

Achievements

Racer
Buzzy Brandy
You can call me Buzzy Brandy, everybody else does. I'm into recreational spankings and a little 'ruff' play. I am not above stealing food off humans' plates. My favorite treat is to steal the pepperoni off of pizza. New experiences? New treats? New places! Yes, please!
  • Purity 23%
  • Age 22 months
  • Racing Exp 16
  • Dachshund 45%
  • 4 races
  • Gen 16
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

4 races   |
  • 0 2 0
 Best Time15.47 sec
No rank  Racing *** Coins
50.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCGGAGGAGGAGGAGGATGATCCCCAAGATTA
T
C
C
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
T
C
C
C
C
A
A
G
A
T
T
A
Genes: NAAAAABN58F

Composition

Dachshund
45%
Pitbull terrier
18%
St. Bernard
9%
Labrador
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect -6 points

Traits Breakdown

Body Pitbull terrier
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Pitbull terrier
Nose Labrador
Eyes Golder Retriever
Color Yorkshire Terrier