Buzzy Brandy Crypto Game Dog - Mix of Dachshund, Pitbull terrier, St. Bernard, Labrador, Golder Retriever and Yorkshire Terrier
Buzzy Brandy
  • Purity 23%
  • Age 13 months
  • Racing Exp 16
  • Dachshund 45%
  • Gold medal 0 Silver medal 2 Bronze medal 0
  • 4 races
  • Gen 16
Depressed & Snaillike

Achievements

Racer

Bio

You can call me Buzzy Brandy, everybody else does. I'm into recreational spankings and a little 'ruff' play. I am not above stealing food off humans' plates. My favorite treat is to steal the pepperoni off of pizza. New experiences? New treats? New places! Yes, please!

Racing Stats

Ran 4 races
  • 0 2 0
 Best Time15.47 sec
Rank 51  RacingĀ *** Pts
50.0 % wins (2) Breeding *** Pts
Scheduled races 0 TotalĀ *** Pts

DNA Analysis

DNA Sequence: TCCGGAGGAGGAGGAGGATGATCCCCAAGATTA
T
C
C
G
G
A
G
G
A
G
G
A
G
G
A
G
G
A
T
G
A
T
C
C
C
C
A
A
G
A
T
T
A
Genes: NAAAAABN58F

Composition

Dachshund
45%
Pitbull terrier
18%
St. Bernard
9%
Labrador
9%
Golder Retriever
9%
Yorkshire Terrier
9%

Current Energy

Vitality -45 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Dachshund
Legs Dachshund
Front Legs Dachshund
Head Dachshund
Ears Dachshund
Snout St. Bernard
Mouth Pitbull terrier
Nose Labrador
Eyes Golder Retriever
Color Yorkshire Terrier

Parents

No Children

Photos

Litecoin doggy race results virtual dog race
Gift